Orthologous regulated operons containing gnd gene

Properties
Regulog:	GntR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Phylum:	Proteobacteria/gamma

Built upon 22 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -109 Score: 4.69736 Sequence: TAACGATAGCGTTAACATTG Locus tag: PE36_03034 Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
gnd	-109	4.7	TAACGATAGCGTTAACATTG	PE36_03034
Psychromonas ingrahamii 37
Position: -98 Score: 5.99049 Sequence: GTAAGTTACCGGTAACATTC Position: -76 Score: 5.19872 Sequence: ATCAGTTACCGGTAACCTAT Locus tag: Ping_2933 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: Ping_2934 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Ping_2935 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Ping_2936 Name: gntK2 Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Ping_2937 Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
gntX-gntY-gntZ-gntK2-gnd	-98	6	GTAAGTTACCGGTAACATTC	Ping_2933
	-76	5.2	ATCAGTTACCGGTAACCTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --