Orthologous regulated operons containing gntK2 gene
| Regulog: | GntR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio splendidus LGP32 | ||||
|
Position: -85
Score: 5.53879 Sequence: TAAAGTTACCGGTAACATCC
Position: -61
Score: 5.75856 Sequence: CAACGTTACCGGTAACATAT
Locus tag: VS_II0405
Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: VS_II0406
Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: VS_II0407
Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: VS_II0408
Name: gntK2 Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: VS_II0409
Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44) |
||||
| gntX-gntY-gntZ-gntK2-gnd | -85 | 5.5 | TAAAGTTACCGGTAACATCC | VS_II0405 |
| -61 | 5.8 | CAACGTTACCGGTAACATAT | ||