Orthologous regulated operons containing mntH gene
| Regulog: | MntR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -27
Score: 5.93778 Sequence: ACTATAGCAGGAGCTATATT
Locus tag: Smlt2838
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -27 | 5.9 | ACTATAGCAGGAGCTATATT | Smlt2838 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -49
Score: 6.2331 Sequence: AGCATAGCAACTGCTATATC
Locus tag: XAC2036
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -49 | 6.2 | AGCATAGCAACTGCTATATC | XAC2036 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -50
Score: 6.2331 Sequence: AGCATAGCACTTGCTATATC
Locus tag: XCC2171
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -50 | 6.2 | AGCATAGCACTTGCTATATC | XCC2171 |
| Xylella fastidiosa 9a5c | ||||
|
Position: 9
Score: 5.62916 Sequence: GGTATAGCCAATGCTATAAG
Locus tag: XF1015
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | 9 | 5.6 | GGTATAGCCAATGCTATAAG | XF1015 |