Orthologous regulated operons containing mntR gene
| Regulog: | MntR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -110
Score: 5.93778 Sequence: AATATAGCTCCTGCTATAGT
Locus tag: Smlt2837
Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family |
||||
| mntR | -110 | 5.9 | AATATAGCTCCTGCTATAGT | Smlt2837 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -113
Score: 6.2331 Sequence: GATATAGCAGTTGCTATGCT
Locus tag: XAC2037
Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family |
||||
| mntR | -113 | 6.2 | GATATAGCAGTTGCTATGCT | XAC2037 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -113
Score: 6.2331 Sequence: GATATAGCAAGTGCTATGCT
Locus tag: XCC2170
Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family |
||||
| mntR | -113 | 6.2 | GATATAGCAAGTGCTATGCT | XCC2170 |
| Xylella fastidiosa 9a5c | ||||
|
Position: -193
Score: 5.62916 Sequence: CTTATAGCATTGGCTATACC
Locus tag: XF1013
Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family |
||||
| mntR | -193 | 5.6 | CTTATAGCATTGGCTATACC | XF1013 |