Orthologous regulated operons containing mntH gene
| Regulog: | MntR - Rhodospirillales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acetobacter pasteurianus IFO 3283-01 | ||||
|
Position: -141
Score: 5.5639 Sequence: AATATTCCATAAAGAATAAA
Position: -48
Score: 5.68271 Sequence: AATATAGCATATTGCATATT
Locus tag: APA01_40840
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -141 | 5.6 | AATATTCCATAAAGAATAAA | APA01_40840 |
| -48 | 5.7 | AATATAGCATATTGCATATT | ||
| Azospirillum sp. B510 | ||||
|
Position: -114
Score: 3.68547 Sequence: AGTATAGCGCCTTGCATACT
Locus tag: AZL_b04520
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -114 | 3.7 | AGTATAGCGCCTTGCATACT | AZL_b04520 |
| Gluconacetobacter diazotrophicus PAl 5 | ||||
|
Position: 16
Score: 5.13522 Sequence: CATATAGCTTATTGCATATT
Locus tag: Gdia_1352
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | 16 | 5.1 | CATATAGCTTATTGCATATT | Gdia_1352 |
| Gluconobacter oxydans 621H | ||||
|
Position: -119
Score: 4.61587 Sequence: ATTATTCACGGCGGAATAAA
Position: -28
Score: 5.63906 Sequence: AATATAGCATGTTGAATATT
Locus tag: GOX2067
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -119 | 4.6 | ATTATTCACGGCGGAATAAA | GOX2067 |
| -28 | 5.6 | AATATAGCATGTTGAATATT | ||