Orthologous regulated operons containing mntH gene
| Regulog: | MntR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -92
Score: 5.44598 Sequence: AATGTAGCAGAAGCTATATC
Locus tag: BBta_1556
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -92 | 5.4 | AATGTAGCAGAAGCTATATC | BBta_1556 |
| Mesorhizobium loti MAFF303099 | ||||
|
Position: -195
Score: 5.19417 Sequence: TTTATAGCACGGGCTCTGAT
Locus tag: mlr2501
Name: mntH Funciton: Manganese transporter, NRAMP family |
||||
| mntH | -195 | 5.2 | TTTATAGCACGGGCTCTGAT | mlr2501 |