Orthologous regulated operons containing cycX gene
| Regulog: | MntR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mesorhizobium sp. BNC1 | ||||
|
Position: -136
Score: 5.05211 Sequence: ATTATAGCCTCGGCTATGGA
Position: -73
Score: 5.82851 Sequence: GAAATAGCATTTGCTATAAT
Locus tag: Meso_4422
Name: COG2132 Funciton: Putative metal oxidase
Locus tag: Meso_4421
Name: COG0428 Funciton: Putative metal cation transporter
Locus tag: Meso_4420
Name: cycX Funciton: Cytochrome c556 |
||||
| COG2132-COG0428-cycX | -136 | 5.1 | ATTATAGCCTCGGCTATGGA | Meso_4422 |
| -73 | 5.8 | GAAATAGCATTTGCTATAAT | ||