Orthologous regulated operons containing cscB gene
| Regulog: | ScrR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azotobacter vinelandii AvOP | ||||
|
Position: -42
Score: 5.1791 Sequence: CGATGTTAACGTTACCTCAA
Locus tag: Avin_51800
Name: cscB Funciton: Sucrose permease, major facilitator superfamily
Locus tag: Avin_51810
Name: cscA Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
||||
| cscB-cscA | -42 | 5.2 | CGATGTTAACGTTACCTCAA | Avin_51800 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -42
Score: 5.58221 Sequence: CGATGTTAACGTTAACCTAA
Locus tag: PFL_3238
Name: cscB Funciton: Sucrose permease, major facilitator superfamily
Locus tag: PFL_3237
Name: cscA Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: PFL_3236
Name: scrR Funciton: Sucrose utilization transcriptional regulator, LacI family |
||||
| cscB-cscA-scrR | -42 | 5.6 | CGATGTTAACGTTAACCTAA | PFL_3238 |