Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cscA gene

Properties
Regulog: ScrR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Proteobacteria/gamma
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azotobacter vinelandii AvOP
Position: -42
Score: 5.1791
Sequence: CGATGTTAACGTTACCTCAA
Locus tag: Avin_51800
Name: cscB
Funciton: Sucrose permease, major facilitator superfamily
Locus tag: Avin_51810
Name: cscA
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
cscB-cscA -42 5.2 CGATGTTAACGTTACCTCAA Avin_51800
Pseudomonas fluorescens Pf-5
Position: -42
Score: 5.58221
Sequence: CGATGTTAACGTTAACCTAA
Locus tag: PFL_3238
Name: cscB
Funciton: Sucrose permease, major facilitator superfamily
Locus tag: PFL_3237
Name: cscA
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: PFL_3236
Name: scrR
Funciton: Sucrose utilization transcriptional regulator, LacI family
cscB-cscA-scrR -42 5.6 CGATGTTAACGTTAACCTAA PFL_3238
Pseudomonas syringae pv. tomato str. DC3000
Position: -46
Score: 6.3774
Sequence: CGATGTTAACGTTAACTTTT
Locus tag: PSPTO0889
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: PSPTO0888
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: PSPTO0887
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: PSPTO0886
Name: aglK
Funciton: Alpha-glucoside ABC transporter ATP-binding protein
Locus tag: PSPTO0885
Name: cscA
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: PSPTO0884
Name: scrR
Funciton: Sucrose utilization transcriptional regulator, LacI family
aglE-aglF-aglG-aglK-cscA-scrR -46 6.4 CGATGTTAACGTTAACTTTT PSPTO0889