Orthologous regulated operons containing aglK gene
| Regulog: | ScrR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas syringae pv. tomato str. DC3000 | ||||
|
Position: -46
Score: 6.3774 Sequence: CGATGTTAACGTTAACTTTT
Locus tag: PSPTO0889
Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: PSPTO0888
Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: PSPTO0887
Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: PSPTO0886
Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
Locus tag: PSPTO0885
Name: cscA Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: PSPTO0884
Name: scrR Funciton: Sucrose utilization transcriptional regulator, LacI family |
||||
| aglE-aglF-aglG-aglK-cscA-scrR | -46 | 6.4 | CGATGTTAACGTTAACTTTT | PSPTO0889 |