Orthologous regulated operons containing qorR gene
| Regulog: | QorR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -62
Score: 6.15017 Sequence: GCACTATCAAAAAGTAAGTGC
Locus tag: cg1552
Name: qorR Funciton: Redox-sensing transcriptional regulator QorR, HxlR family |
||||
| qorR | -62 | 6.2 | GCACTATCAAAAAGTAAGTGC | cg1552 |