Orthologous regulated operons containing qorB gene
| Regulog: | QorR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -65
Score: 6.15017 Sequence: GCACTTACTTTTTGATAGTGC
Locus tag: cg1553
Name: qorB Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
||||
| qorB | -65 | 6.2 | GCACTTACTTTTTGATAGTGC | cg1553 |