Orthologous regulated operons containing SCO2752 gene

Properties
Regulog:	Arth_2426 - Micrococcineae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Actinobacteria

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Arthrobacter chlorophenolicus A6
Position: -110 Score: 5.89967 Sequence: TCCGGAAAGCGCTTGCCAAC Position: -61 Score: 6.24395 Sequence: GTGGGAATGCGCTTTCCCAA Locus tag: Achl_2179 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: Achl_2178 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: Achl_2177 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
SCO2752-SCO2751-SCO2750	-110	5.9	TCCGGAAAGCGCTTGCCAAC	Achl_2179
	-61	6.2	GTGGGAATGCGCTTTCCCAA
Arthrobacter sp. FB24
Position: -103 Score: 5.74855 Sequence: TCGGGAAAGCGCTTGCCATG Position: -55 Score: 6.13504 Sequence: GTGGGAATGCGCTTTCCCAG Locus tag: Arth_2425 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: Arth_2424 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: Arth_2423 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
SCO2752-SCO2751-SCO2750	-103	5.7	TCGGGAAAGCGCTTGCCATG	Arth_2425
	-55	6.1	GTGGGAATGCGCTTTCCCAG
Beutenbergia cavernae DSM 12333
Position: -31 Score: 5.84884 Sequence: GCCGGAAAGCGCATTCCCTA Locus tag: Bcav_3365 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: Bcav_3366 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: Bcav_3367 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
SCO2752-SCO2751-SCO2750	-31	5.8	GCCGGAAAGCGCATTCCCTA	Bcav_3365
Brachybacterium faecium DSM 4810
Position: -116 Score: 5.50025 Sequence: CTGGACAAGCGCTTGCCCGA Locus tag: Bfae_29090 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: Bfae_29080 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: Bfae_29070 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
SCO2752-SCO2751-SCO2750	-116	5.5	CTGGACAAGCGCTTGCCCGA	Bfae_29090
Janibacter sp. HTCC2649
Position: -61 Score: 5.39524 Sequence: AGCGGAAAGCGCTCTCCGCA Locus tag: JNB_06199 Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, transmembrane component Locus tag: JNB_06204 Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, substrate-binding component Locus tag: JNB_06209 Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, ATPase component Locus tag: JNB_06214 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: JNB_06219 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: JNB_06224 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
JNB_06199-JNB_06204-JNB_06209-SCO2752-SCO2751-SCO2750	-61	5.4	AGCGGAAAGCGCTCTCCGCA	JNB_06199