Orthologous regulated operons containing SCO2752 gene
| Regulog: | Arth_2426 - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Arthrobacter chlorophenolicus A6 | ||||
|
Position: -110
Score: 5.89967 Sequence: TCCGGAAAGCGCTTGCCAAC
Position: -61
Score: 6.24395 Sequence: GTGGGAATGCGCTTTCCCAA
Locus tag: Achl_2179
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: Achl_2178
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: Achl_2177
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -110 | 5.9 | TCCGGAAAGCGCTTGCCAAC | Achl_2179 |
| -61 | 6.2 | GTGGGAATGCGCTTTCCCAA | ||
| Arthrobacter sp. FB24 | ||||
|
Position: -103
Score: 5.74855 Sequence: TCGGGAAAGCGCTTGCCATG
Position: -55
Score: 6.13504 Sequence: GTGGGAATGCGCTTTCCCAG
Locus tag: Arth_2425
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: Arth_2424
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: Arth_2423
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -103 | 5.7 | TCGGGAAAGCGCTTGCCATG | Arth_2425 |
| -55 | 6.1 | GTGGGAATGCGCTTTCCCAG | ||
| Beutenbergia cavernae DSM 12333 | ||||
|
Position: -31
Score: 5.84884 Sequence: GCCGGAAAGCGCATTCCCTA
Locus tag: Bcav_3365
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: Bcav_3366
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: Bcav_3367
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -31 | 5.8 | GCCGGAAAGCGCATTCCCTA | Bcav_3365 |
| Brachybacterium faecium DSM 4810 | ||||
|
Position: -116
Score: 5.50025 Sequence: CTGGACAAGCGCTTGCCCGA
Locus tag: Bfae_29090
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: Bfae_29080
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: Bfae_29070
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -116 | 5.5 | CTGGACAAGCGCTTGCCCGA | Bfae_29090 |
| Janibacter sp. HTCC2649 | ||||
|
Position: -61
Score: 5.39524 Sequence: AGCGGAAAGCGCTCTCCGCA
Locus tag: JNB_06199
Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, transmembrane component
Locus tag: JNB_06204
Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, substrate-binding component
Locus tag: JNB_06209
Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, ATPase component
Locus tag: JNB_06214
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: JNB_06219
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: JNB_06224
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| JNB_06199-JNB_06204-JNB_06209-SCO2752-SCO2751-SCO2750 | -61 | 5.4 | AGCGGAAAGCGCTCTCCGCA | JNB_06199 |