Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing JNB_06199 gene

Properties
Regulog: Arth_2426 - Micrococcineae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Janibacter sp. HTCC2649
Position: -61
Score: 5.39524
Sequence: AGCGGAAAGCGCTCTCCGCA
Locus tag: JNB_06199
Name: null
Funciton: Hydroxymethylpyrimidine ABC transporter, transmembrane component
Locus tag: JNB_06204
Name: null
Funciton: Hydroxymethylpyrimidine ABC transporter, substrate-binding component
Locus tag: JNB_06209
Name: null
Funciton: Hydroxymethylpyrimidine ABC transporter, ATPase component
Locus tag: JNB_06214
Name: SCO2752
Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: JNB_06219
Name: SCO2751
Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: JNB_06224
Name: SCO2750
Funciton: Predicted sugar phosphate isomerases/epimerase
JNB_06199-JNB_06204-JNB_06209-SCO2752-SCO2751-SCO2750 -61 5.4 AGCGGAAAGCGCTCTCCGCA JNB_06199
© 2009-2020 RegPrecise