Orthologous regulated operons containing ycjS gene

Properties
Regulog:	YcjW - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -78 Score: 5.71736 Sequence: AACTGGGAGCGATTCCATAA Locus tag: lin2972 Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN Locus tag: lin2971 Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO Locus tag: lin2970 Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP Locus tag: lin2969 Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ Locus tag: lin2968 Name: null Funciton: Sugar phosphate isomerases/epimerases family protein YcjR Locus tag: lin2967 Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding Locus tag: lin2966 Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
ycjN-ycjO-ycjP-ycjQ-lin2968-ycjS-ycjT	-78	5.7	AACTGGGAGCGATTCCATAA	lin2972
Listeria monocytogenes EGD-e
Position: -78 Score: 5.71736 Sequence: AACTGGGAGCGATTCCATAA Locus tag: lmo2839 Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN Locus tag: lmo2838 Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO Locus tag: lmo2837 Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP Locus tag: lmo2836 Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ Locus tag: lmo2835 Name: null Funciton: Sugar phosphate isomerases/epimerases family protein YcjR Locus tag: lmo2834 Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding Locus tag: lmo2833 Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
ycjN-ycjO-ycjP-ycjQ-lmo2835-ycjS-ycjT	-78	5.7	AACTGGGAGCGATTCCATAA	lmo2839
Listeria welshimeri serovar 6b str. SLCC5334
Position: -78 Score: 5.71736 Sequence: AACTGGGAGCGATTCCATAA Locus tag: lwe2769 Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN Locus tag: lwe2768 Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO Locus tag: lwe2767 Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP Locus tag: lwe2766 Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ Locus tag: lwe2765 Name: ycjR Funciton: Sugar phosphate isomerases/epimerases family protein YcjR Locus tag: lwe2764 Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding Locus tag: lwe2763 Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
ycjN-ycjO-ycjP-ycjQ-ycjR-ycjS-ycjT	-78	5.7	AACTGGGAGCGATTCCATAA	lwe2769