Orthologous regulated operons containing ycjS gene
| Regulog: | YcjW - Listeriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Listeria innocua Clip11262 | ||||
|
Position: -78
Score: 5.71736 Sequence: AACTGGGAGCGATTCCATAA
Locus tag: lin2972
Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN
Locus tag: lin2971
Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: lin2970
Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: lin2969
Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ
Locus tag: lin2968
Name: null Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: lin2967
Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
Locus tag: lin2966
Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-) |
||||
| ycjN-ycjO-ycjP-ycjQ-lin2968-ycjS-ycjT | -78 | 5.7 | AACTGGGAGCGATTCCATAA | lin2972 |
| Listeria monocytogenes EGD-e | ||||
|
Position: -78
Score: 5.71736 Sequence: AACTGGGAGCGATTCCATAA
Locus tag: lmo2839
Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN
Locus tag: lmo2838
Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: lmo2837
Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: lmo2836
Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ
Locus tag: lmo2835
Name: null Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: lmo2834
Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
Locus tag: lmo2833
Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-) |
||||
| ycjN-ycjO-ycjP-ycjQ-lmo2835-ycjS-ycjT | -78 | 5.7 | AACTGGGAGCGATTCCATAA | lmo2839 |
| Listeria welshimeri serovar 6b str. SLCC5334 | ||||
|
Position: -78
Score: 5.71736 Sequence: AACTGGGAGCGATTCCATAA
Locus tag: lwe2769
Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN
Locus tag: lwe2768
Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: lwe2767
Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: lwe2766
Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ
Locus tag: lwe2765
Name: ycjR Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: lwe2764
Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
Locus tag: lwe2763
Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-) |
||||
| ycjN-ycjO-ycjP-ycjQ-ycjR-ycjS-ycjT | -78 | 5.7 | AACTGGGAGCGATTCCATAA | lwe2769 |