Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ycjR gene

Properties
Regulog: YcjW - Listeriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Firmicutes
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -78
Score: 5.71736
Sequence: AACTGGGAGCGATTCCATAA
Locus tag: lin2972
Name: ycjN
Funciton: Sugar ABC transport system, periplasmic binding protein YcjN
Locus tag: lin2971
Name: ycjO
Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: lin2970
Name: ycjP
Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: lin2969
Name: ycjQ
Funciton: Zinc-type alcohol dehydrogenase YcjQ
Locus tag: lin2968
Name: null
Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: lin2967
Name: ycjS
Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
Locus tag: lin2966
Name: ycjT
Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
ycjN-ycjO-ycjP-ycjQ-lin2968-ycjS-ycjT -78 5.7 AACTGGGAGCGATTCCATAA lin2972
Listeria monocytogenes EGD-e
Position: -78
Score: 5.71736
Sequence: AACTGGGAGCGATTCCATAA
Locus tag: lmo2839
Name: ycjN
Funciton: Sugar ABC transport system, periplasmic binding protein YcjN
Locus tag: lmo2838
Name: ycjO
Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: lmo2837
Name: ycjP
Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: lmo2836
Name: ycjQ
Funciton: Zinc-type alcohol dehydrogenase YcjQ
Locus tag: lmo2835
Name: null
Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: lmo2834
Name: ycjS
Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
Locus tag: lmo2833
Name: ycjT
Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
ycjN-ycjO-ycjP-ycjQ-lmo2835-ycjS-ycjT -78 5.7 AACTGGGAGCGATTCCATAA lmo2839
Listeria welshimeri serovar 6b str. SLCC5334
Position: -78
Score: 5.71736
Sequence: AACTGGGAGCGATTCCATAA
Locus tag: lwe2769
Name: ycjN
Funciton: Sugar ABC transport system, periplasmic binding protein YcjN
Locus tag: lwe2768
Name: ycjO
Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: lwe2767
Name: ycjP
Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: lwe2766
Name: ycjQ
Funciton: Zinc-type alcohol dehydrogenase YcjQ
Locus tag: lwe2765
Name: ycjR
Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: lwe2764
Name: ycjS
Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
Locus tag: lwe2763
Name: ycjT
Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
ycjN-ycjO-ycjP-ycjQ-ycjR-ycjS-ycjT -78 5.7 AACTGGGAGCGATTCCATAA lwe2769