Orthologous regulated operons containing BH1516 gene
| Regulog: | BH1516 - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus halodurans C-125 | ||||
|
Position: -34
Score: 5.96819 Sequence: CACAGAAAACGTTTTCGTTT
Locus tag: BH1516
Name: BH1516 Funciton: Putative maltose catabolism transcriptional regulator, LacI family |
||||
| BH1516 | -34 | 6 | CACAGAAAACGTTTTCGTTT | BH1516 |