Orthologous regulated operons containing msmE gene
| Regulog: | BH1516 - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus clausii KSM-K16 | ||||
|
Position: 4
Score: 5.60251 Sequence: ATACGAAAACGTTTACTCCC
Position: 35
Score: 6.25033 Sequence: TAACGTAAACGTTTACTATA
Locus tag: ABC3496
Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein
Locus tag: ABC3497
Name: msmF Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
Locus tag: ABC3498
Name: msmG Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
||||
| msmE-msmF-msmG | 4 | 5.6 | ATACGAAAACGTTTACTCCC | ABC3496 |
| 35 | 6.3 | TAACGTAAACGTTTACTATA | ||