Orthologous regulated operons containing celR gene

Properties
Regulog:	CelR - Micrococcineae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Phylum:	Actinobacteria

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -115 Score: 4.64947 Sequence: GTCAGAGAGCGCTCTCTTGA Position: -59 Score: 4.93141 Sequence: CTCAGAGAGCGCTCTCTCGC Locus tag: AAur_0088 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: AAur_0087 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: AAur_0086 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: AAur_0085 Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: AAur_0084 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR	-115	4.6	GTCAGAGAGCGCTCTCTTGA	AAur_0088
	-59	4.9	CTCAGAGAGCGCTCTCTCGC
Arthrobacter chlorophenolicus A6
Position: -226 Score: 5.89913 Sequence: TGGTGGGAGCGCTCCCGTCG Position: -170 Score: 4.86772 Sequence: CGATGGGAGCGCTCCTAAAT Position: -115 Score: 6.03332 Sequence: TGGTGAGAGCGCTCCCATGA Locus tag: Achl_0399 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: Achl_0400 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: Achl_0401 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: Achl_0402 Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Achl_0403 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR	-226	5.9	TGGTGGGAGCGCTCCCGTCG	Achl_0399
	-170	4.9	CGATGGGAGCGCTCCTAAAT
	-115	6	TGGTGAGAGCGCTCCCATGA
Beutenbergia cavernae DSM 12333
Position: -132 Score: 6.14418 Sequence: CCGTGAGAGCGCTCCCATGG Position: -96 Score: 5.96195 Sequence: CCTTGGGAGCGCTCTCACCA Locus tag: Bcav_2837 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: Bcav_2838 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: Bcav_2839 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: Bcav_2840 Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Bcav_2841 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR	-132	6.1	CCGTGAGAGCGCTCCCATGG	Bcav_2837
	-96	6	CCTTGGGAGCGCTCTCACCA
Jonesia denitrificans DSM 20603
Position: -340 Score: 6.08425 Sequence: CGGTGGGAACGTTCCCACCG Position: -158 Score: 5.33225 Sequence: AGGTGGAAACGCTCCCACGC Position: -124 Score: 5.60155 Sequence: CGGTGGGAGCGCTACCAGAA Locus tag: Jden_1882 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: Jden_1881 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: Jden_1880 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: Jden_1879 Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Jden_1878 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR	-340	6.1	CGGTGGGAACGTTCCCACCG	Jden_1882
	-158	5.3	AGGTGGAAACGCTCCCACGC
	-124	5.6	CGGTGGGAGCGCTACCAGAA