Orthologous regulated operons containing cebF gene
Regulog: | CelR - Micrococcineae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Cellobiose utilization |
Effector: | Cellobiose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Arthrobacter aurescens TC1 | ||||
Position: -115
Score: 4.64947 Sequence: GTCAGAGAGCGCTCTCTTGA
Position: -59
Score: 4.93141 Sequence: CTCAGAGAGCGCTCTCTCGC
Locus tag: AAur_0088
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: AAur_0087
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: AAur_0086
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: AAur_0085
Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: AAur_0084
Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family |
||||
cebE-cebF-cebG-bglC-celR | -115 | 4.6 | GTCAGAGAGCGCTCTCTTGA | AAur_0088 |
-59 | 4.9 | CTCAGAGAGCGCTCTCTCGC | ||
Arthrobacter chlorophenolicus A6 | ||||
Position: -226
Score: 5.89913 Sequence: TGGTGGGAGCGCTCCCGTCG
Position: -170
Score: 4.86772 Sequence: CGATGGGAGCGCTCCTAAAT
Position: -115
Score: 6.03332 Sequence: TGGTGAGAGCGCTCCCATGA
Locus tag: Achl_0399
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: Achl_0400
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: Achl_0401
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: Achl_0402
Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Achl_0403
Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family |
||||
cebE-cebF-cebG-bglC-celR | -226 | 5.9 | TGGTGGGAGCGCTCCCGTCG | Achl_0399 |
-170 | 4.9 | CGATGGGAGCGCTCCTAAAT | ||
-115 | 6 | TGGTGAGAGCGCTCCCATGA | ||
Beutenbergia cavernae DSM 12333 | ||||
Position: -132
Score: 6.14418 Sequence: CCGTGAGAGCGCTCCCATGG
Position: -96
Score: 5.96195 Sequence: CCTTGGGAGCGCTCTCACCA
Locus tag: Bcav_2837
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: Bcav_2838
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: Bcav_2839
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: Bcav_2840
Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Bcav_2841
Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family |
||||
cebE-cebF-cebG-bglC-celR | -132 | 6.1 | CCGTGAGAGCGCTCCCATGG | Bcav_2837 |
-96 | 6 | CCTTGGGAGCGCTCTCACCA | ||
Jonesia denitrificans DSM 20603 | ||||
Position: -340
Score: 6.08425 Sequence: CGGTGGGAACGTTCCCACCG
Position: -158
Score: 5.33225 Sequence: AGGTGGAAACGCTCCCACGC
Position: -124
Score: 5.60155 Sequence: CGGTGGGAGCGCTACCAGAA
Locus tag: Jden_1882
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: Jden_1881
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: Jden_1880
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: Jden_1879
Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Jden_1878
Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family |
||||
cebE-cebF-cebG-bglC-celR | -340 | 6.1 | CGGTGGGAACGTTCCCACCG | Jden_1882 |
-158 | 5.3 | AGGTGGAAACGCTCCCACGC | ||
-124 | 5.6 | CGGTGGGAGCGCTACCAGAA |