Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF0583 gene

Properties
Regulog: Caur_3587 - Chloroflexia
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process:
Effector:
Phylum: Chloroflexi
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Herpetosiphon aurantiacus ATCC 23779
Position: -50
Score: 5.53072
Sequence: ATATTGAATTAATTCGATAA
Locus tag: Haur_0112
Name: Caur_3587
Funciton: transcriptional regulator, ArsR family
Locus tag: Haur_0111
Name: PF0583
Funciton: GCN5-related N-acetyltransferase (GNAT) domain
Locus tag: Haur_0110
Name: ubiE
Funciton: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
Caur_3587-PF0583-ubiE -50 5.5 ATATTGAATTAATTCGATAA Haur_0112
Roseiflexus castenholzii DSM 13941
Position: -252
Score: 5.57405
Sequence: ATATCGATGATCATCAATAC
Locus tag: Rcas_2311
Name: PF0583
Funciton: GCN5-related N-acetyltransferase (GNAT) domain
Locus tag: Rcas_2312
Name: ubiE
Funciton: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
PF0583-ubiE -252 5.6 ATATCGATGATCATCAATAC Rcas_2311
© 2009-2020 RegPrecise