Orthologous regulated operons containing celH gene
| Regulog: | CelR3 - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -19
Score: 6.04952 Sequence: TACGGAAACCGGTTTCCATT
Locus tag: PBPRB2008
Name: celB2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: PBPRB2007
Name: celD2 Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: PBPRB2006
Name: celH Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: PBPRB2005
Name: celA2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
||||
| celB2-celD2-celH-celA2 | -19 | 6 | TACGGAAACCGGTTTCCATT | PBPRB2008 |