Orthologous regulated operons containing manK2 gene
| Regulog: | ManR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannosides utilization; Mannose utilization |
| Effector: | Mannose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -144
Score: 5.57597 Sequence: TACTTGAATCGATCTAAATT
Locus tag: Smlt2180
Name: mnnA Funciton: Alpha-1,2-mannosidase
Locus tag: Smlt2181
Name: manR Funciton: Mannose utilization transcriptional regulator ManR, LacI family
Locus tag: Smlt2182
Name: manP Funciton: Predicted mannose transporter, GGP family
Locus tag: Smlt2183
Name: manK2 Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Locus tag: Smlt2184
Name: manI2 Funciton: D-mannose isomerase (EC 5.3.1.7)
Locus tag: Smlt2185
Name: mnnB Funciton: Beta-mannosidase (EC 3.2.1.25) |
||||
| mnnA-manR-manP-manK2-manI2-mnnB | -144 | 5.6 | TACTTGAATCGATCTAAATT | Smlt2180 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -90
Score: 6.3178 Sequence: TAATTGGATCGATCCAATTT
Locus tag: XAC1555
Name: manR Funciton: Mannose utilization transcriptional regulator ManR, LacI family
Locus tag: XAC1556
Name: manP Funciton: Predicted mannose transporter, GGP family
Locus tag: XAC1557
Name: manK2 Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Locus tag: XAC1558
Name: manI2 Funciton: D-mannose isomerase (EC 5.3.1.7) |
||||
| manR-manP-manK2-manI2 | -90 | 6.3 | TAATTGGATCGATCCAATTT | XAC1555 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -132
Score: 6.16696 Sequence: TAATTGGATCGATCCAATCA
Locus tag: XCC1507
Name: manR Funciton: Mannose utilization transcriptional regulator ManR, LacI family
Locus tag: XCC1508
Name: manP Funciton: Predicted mannose transporter, GGP family
Locus tag: XCC1509
Name: manK2 Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Locus tag: XCC1510
Name: manI2 Funciton: D-mannose isomerase (EC 5.3.1.7) |
||||
| manR-manP-manK2-manI2 | -132 | 6.2 | TAATTGGATCGATCCAATCA | XCC1507 |