Orthologous regulated operons containing omp(Man)-2 gene

Properties
Regulog:	ManR - Xanthomonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Phylum:	Proteobacteria/gamma

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -123 Score: 5.42791 Sequence: AGTTTGGATCGATCCACAGG Position: -87 Score: 3.96265 Sequence: GTCTTGAACCGATCCAGGTG Locus tag: Smlt2175 Name: omp(Man)-2 Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
omp(Man)-2	-123	5.4	AGTTTGGATCGATCCACAGG	Smlt2175
	-87	4	GTCTTGAACCGATCCAGGTG
Xanthomonas campestris pv. campestris str. ATCC 33913
Position: -92 Score: 5.57672 Sequence: GATTTGGATCGGTCCAAAGC Locus tag: XCC4222 Name: omp(Man)-2 Funciton: Mannosides-regulated TonB-dependent outer membrane receptor Locus tag: XCC4221 Name: mnnA Funciton: Alpha-1,2-mannosidase
omp(Man)-2-mnnA	-92	5.6	GATTTGGATCGGTCCAAAGC	XCC4222

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --