Orthologous regulated operons containing malZ gene
| Regulog: | MalR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltodextrin utilization; Maltose utilization |
| Effector: | Maltose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -91
Score: 6.40075 Sequence: GCGTGAATACGTATGCAGGT
Locus tag: Smlt1174
Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20) |
||||
| malZ | -91 | 6.4 | GCGTGAATACGTATGCAGGT | Smlt1174 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -107
Score: 6.73718 Sequence: CAATGAATACGTATGCACGT
Locus tag: XAC2602
Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20) |
||||
| malZ | -107 | 6.7 | CAATGAATACGTATGCACGT | XAC2602 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -107
Score: 6.66446 Sequence: CTATGAATACGTATGCACGG
Locus tag: XCC2471
Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20) |
||||
| malZ | -107 | 6.7 | CTATGAATACGTATGCACGG | XCC2471 |