Orthologous regulated operons containing malT gene
| Regulog: | MalR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltodextrin utilization; Maltose utilization |
| Effector: | Maltose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -101
Score: 6.4918 Sequence: CCATGAATACGTATGCAGCT
Locus tag: Smlt1177
Name: COG3408 Funciton: Glycogen debranching enzyme
Locus tag: Smlt1178
Name: malT Funciton: Predicted maltose transporter MalT
Locus tag: Smlt1179
Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19 |
||||
| COG3408-malT-cgt | -101 | 6.5 | CCATGAATACGTATGCAGCT | Smlt1177 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -158
Score: 6.7432 Sequence: CCATGAATACGTATGCAGTG
Locus tag: XAC2598
Name: COG3408 Funciton: Glycogen debranching enzyme
Locus tag: XAC2597
Name: malT Funciton: Predicted maltose transporter MalT
Locus tag: XAC2596
Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19 |
||||
| COG3408-malT-cgt | -158 | 6.7 | CCATGAATACGTATGCAGTG | XAC2598 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -159
Score: 6.96395 Sequence: CCATGAATACGTATGCAGGG
Locus tag: XCC2467
Name: COG3408 Funciton: Glycogen debranching enzyme
Locus tag: XCC2466
Name: malT Funciton: Predicted maltose transporter MalT
Locus tag: XCC2465
Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19 |
||||
| COG3408-malT-cgt | -159 | 7 | CCATGAATACGTATGCAGGG | XCC2467 |