Orthologous regulated operons containing COG3408 gene

Properties
Regulog:	MalR - Xanthomonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltodextrin utilization; Maltose utilization
Effector:	Maltose
Phylum:	Proteobacteria/gamma

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -101 Score: 6.4918 Sequence: CCATGAATACGTATGCAGCT Locus tag: Smlt1177 Name: COG3408 Funciton: Glycogen debranching enzyme Locus tag: Smlt1178 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: Smlt1179 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
COG3408-malT-cgt	-101	6.5	CCATGAATACGTATGCAGCT	Smlt1177
Xanthomonas axonopodis pv. citri str. 306
Position: -158 Score: 6.7432 Sequence: CCATGAATACGTATGCAGTG Locus tag: XAC2598 Name: COG3408 Funciton: Glycogen debranching enzyme Locus tag: XAC2597 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: XAC2596 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
COG3408-malT-cgt	-158	6.7	CCATGAATACGTATGCAGTG	XAC2598
Xanthomonas campestris pv. campestris str. ATCC 33913
Position: -159 Score: 6.96395 Sequence: CCATGAATACGTATGCAGGG Locus tag: XCC2467 Name: COG3408 Funciton: Glycogen debranching enzyme Locus tag: XCC2466 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: XCC2465 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
COG3408-malT-cgt	-159	7	CCATGAATACGTATGCAGGG	XCC2467

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --