Orthologous regulated operons containing tolB gene
Regulog: | Caur_3866 - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Beta-glucoside |
Phylum: | Chloroflexi |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Chloroflexus aggregans DSM 9485 | ||||
Position: -77
Score: 4.89623 Sequence: AAAGTGAAACATTTCACCGA
Position: -3
Score: 5.88396 Sequence: TTTATGAAACGTTACACTCT
Position: 103
Score: 5.98688 Sequence: TTTGTGAAACGTTTCATCCA
Locus tag: Cagg_0091
Name: COG3459 Funciton: Cellobiose phosphorylase
Locus tag: Cagg_0090
Name: Caur_3857 Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Cagg_0089
Name: Caur_3858 Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Cagg_0088
Name: Caur_3859 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0087
Name: Caur_3860 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0086
Name: tolB Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein
Locus tag: Cagg_0085
Name: Caur_3862 Funciton: hypothetical protein
Locus tag: Cagg_0084
Name: Caur_3863 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0083
Name: Caur_3864 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0082
Name: COG5368 Funciton: conserved hypothetical protein
Locus tag: Cagg_0081
Name: bglR Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Locus tag: Cagg_0080
Name: Caur_3867 Funciton: conserved hypothetical protein
Locus tag: Cagg_0079
Name: GH35 Funciton: glycoside hydrolase family 35
Locus tag: Cagg_0078
Name: bglX Funciton: Beta-glucosidase-related glycosidase |
||||
COG3459-Caur_3857-Caur_3858-Caur_3859-Caur_3860-tolB-Caur_3862-Caur_3863-Caur_3864-COG5368-bglR-Caur_3867-GH35-bglX | -77 | 4.9 | AAAGTGAAACATTTCACCGA | Cagg_0091 |
-3 | 5.9 | TTTATGAAACGTTACACTCT | ||
103 | 6 | TTTGTGAAACGTTTCATCCA | ||
Chloroflexus sp. Y-400-fl | ||||
Position: -193
Score: 5.91494 Sequence: CGTATGAAACGTTACACAAA
Position: -88
Score: 6.1064 Sequence: GTAATGAAACGTTTCATACC
Locus tag: Chy400_4165
Name: COG3459 Funciton: Cellobiose phosphorylase
Locus tag: Chy400_4166
Name: Caur_3857 Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Chy400_4167
Name: Caur_3858 Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Chy400_4168
Name: Caur_3859 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4169
Name: Caur_3860 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4170
Name: tolB Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein
Locus tag: Chy400_4171
Name: Caur_3862 Funciton: hypothetical protein
Locus tag: Chy400_4172
Name: Caur_3863 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4173
Name: Caur_3864 Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4174
Name: COG5368 Funciton: conserved hypothetical protein
Locus tag: Chy400_4175
Name: bglR Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Locus tag: Chy400_4176
Name: Caur_3867 Funciton: conserved hypothetical protein
Locus tag: Chy400_4177
Name: GH35 Funciton: glycoside hydrolase family 35
Locus tag: Chy400_4178
Name: bglX Funciton: Beta-glucosidase-related glycosidase |
||||
COG3459-Caur_3857-Caur_3858-Caur_3859-Caur_3860-tolB-Caur_3862-Caur_3863-Caur_3864-COG5368-bglR-Caur_3867-GH35-bglX | -193 | 5.9 | CGTATGAAACGTTACACAAA | Chy400_4165 |
-88 | 6.1 | GTAATGAAACGTTTCATACC |