Orthologous regulated operons containing COG5368 gene

Properties
Regulog:	Caur_3866 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Chloroflexi

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -77 Score: 4.89623 Sequence: AAAGTGAAACATTTCACCGA Position: -3 Score: 5.88396 Sequence: TTTATGAAACGTTACACTCT Position: 103 Score: 5.98688 Sequence: TTTGTGAAACGTTTCATCCA Locus tag: Cagg_0091 Name: COG3459 Funciton: Cellobiose phosphorylase Locus tag: Cagg_0090 Name: Caur_3857 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Cagg_0089 Name: Caur_3858 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Cagg_0088 Name: Caur_3859 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0087 Name: Caur_3860 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0086 Name: tolB Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein Locus tag: Cagg_0085 Name: Caur_3862 Funciton: hypothetical protein Locus tag: Cagg_0084 Name: Caur_3863 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0083 Name: Caur_3864 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0082 Name: COG5368 Funciton: conserved hypothetical protein Locus tag: Cagg_0081 Name: bglR Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family Locus tag: Cagg_0080 Name: Caur_3867 Funciton: conserved hypothetical protein Locus tag: Cagg_0079 Name: GH35 Funciton: glycoside hydrolase family 35 Locus tag: Cagg_0078 Name: bglX Funciton: Beta-glucosidase-related glycosidase
COG3459-Caur_3857-Caur_3858-Caur_3859-Caur_3860-tolB-Caur_3862-Caur_3863-Caur_3864-COG5368-bglR-Caur_3867-GH35-bglX	-77	4.9	AAAGTGAAACATTTCACCGA	Cagg_0091
	-3	5.9	TTTATGAAACGTTACACTCT
	103	6	TTTGTGAAACGTTTCATCCA
Chloroflexus sp. Y-400-fl
Position: -193 Score: 5.91494 Sequence: CGTATGAAACGTTACACAAA Position: -88 Score: 6.1064 Sequence: GTAATGAAACGTTTCATACC Locus tag: Chy400_4165 Name: COG3459 Funciton: Cellobiose phosphorylase Locus tag: Chy400_4166 Name: Caur_3857 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Chy400_4167 Name: Caur_3858 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Chy400_4168 Name: Caur_3859 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4169 Name: Caur_3860 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4170 Name: tolB Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein Locus tag: Chy400_4171 Name: Caur_3862 Funciton: hypothetical protein Locus tag: Chy400_4172 Name: Caur_3863 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4173 Name: Caur_3864 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4174 Name: COG5368 Funciton: conserved hypothetical protein Locus tag: Chy400_4175 Name: bglR Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family Locus tag: Chy400_4176 Name: Caur_3867 Funciton: conserved hypothetical protein Locus tag: Chy400_4177 Name: GH35 Funciton: glycoside hydrolase family 35 Locus tag: Chy400_4178 Name: bglX Funciton: Beta-glucosidase-related glycosidase
COG3459-Caur_3857-Caur_3858-Caur_3859-Caur_3860-tolB-Caur_3862-Caur_3863-Caur_3864-COG5368-bglR-Caur_3867-GH35-bglX	-193	5.9	CGTATGAAACGTTACACAAA	Chy400_4165
	-88	6.1	GTAATGAAACGTTTCATACC