Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Caur_3858 gene

Properties
Regulog: Caur_3866 - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Chloroflexi
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -77
Score: 4.89623
Sequence: AAAGTGAAACATTTCACCGA
Position: -3
Score: 5.88396
Sequence: TTTATGAAACGTTACACTCT
Position: 103
Score: 5.98688
Sequence: TTTGTGAAACGTTTCATCCA
Locus tag: Cagg_0091
Name: COG3459
Funciton: Cellobiose phosphorylase
Locus tag: Cagg_0090
Name: Caur_3857
Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Cagg_0089
Name: Caur_3858
Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Cagg_0088
Name: Caur_3859
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0087
Name: Caur_3860
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0086
Name: tolB
Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein
Locus tag: Cagg_0085
Name: Caur_3862
Funciton: hypothetical protein
Locus tag: Cagg_0084
Name: Caur_3863
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0083
Name: Caur_3864
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Cagg_0082
Name: COG5368
Funciton: conserved hypothetical protein
Locus tag: Cagg_0081
Name: bglR
Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Locus tag: Cagg_0080
Name: Caur_3867
Funciton: conserved hypothetical protein
Locus tag: Cagg_0079
Name: GH35
Funciton: glycoside hydrolase family 35
Locus tag: Cagg_0078
Name: bglX
Funciton: Beta-glucosidase-related glycosidase
COG3459-Caur_3857-Caur_3858-Caur_3859-Caur_3860-tolB-Caur_3862-Caur_3863-Caur_3864-COG5368-bglR-Caur_3867-GH35-bglX -77 4.9 AAAGTGAAACATTTCACCGA Cagg_0091
-3 5.9 TTTATGAAACGTTACACTCT
103 6 TTTGTGAAACGTTTCATCCA
Chloroflexus sp. Y-400-fl
Position: -193
Score: 5.91494
Sequence: CGTATGAAACGTTACACAAA
Position: -88
Score: 6.1064
Sequence: GTAATGAAACGTTTCATACC
Locus tag: Chy400_4165
Name: COG3459
Funciton: Cellobiose phosphorylase
Locus tag: Chy400_4166
Name: Caur_3857
Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Chy400_4167
Name: Caur_3858
Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Chy400_4168
Name: Caur_3859
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4169
Name: Caur_3860
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4170
Name: tolB
Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein
Locus tag: Chy400_4171
Name: Caur_3862
Funciton: hypothetical protein
Locus tag: Chy400_4172
Name: Caur_3863
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4173
Name: Caur_3864
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4174
Name: COG5368
Funciton: conserved hypothetical protein
Locus tag: Chy400_4175
Name: bglR
Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Locus tag: Chy400_4176
Name: Caur_3867
Funciton: conserved hypothetical protein
Locus tag: Chy400_4177
Name: GH35
Funciton: glycoside hydrolase family 35
Locus tag: Chy400_4178
Name: bglX
Funciton: Beta-glucosidase-related glycosidase
COG3459-Caur_3857-Caur_3858-Caur_3859-Caur_3860-tolB-Caur_3862-Caur_3863-Caur_3864-COG5368-bglR-Caur_3867-GH35-bglX -193 5.9 CGTATGAAACGTTACACAAA Chy400_4165
-88 6.1 GTAATGAAACGTTTCATACC