Orthologous regulated operons containing bfrA gene
Regulog: | BfrR - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Fructooligosaccharides utilization |
Effector: | |
Phylum: | Chloroflexi |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Chloroflexus aggregans DSM 9485 | ||||
Position: -46
Score: 6.3673 Sequence: GTCAATGGACGACCAATCTC
Locus tag: Cagg_3715
Name: bfrR Funciton: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
Locus tag: Cagg_3716
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: Cagg_3717
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: Cagg_3718
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: Cagg_3719
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) |
||||
bfrR-bfrE-bfrF-bfrG-bfrA | -46 | 6.4 | GTCAATGGACGACCAATCTC | Cagg_3715 |
Chloroflexus sp. Y-400-fl | ||||
Position: -46
Score: 6.17585 Sequence: GTCAATGAACGACCAATCTC
Locus tag: Chy400_2954
Name: bfrR Funciton: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
Locus tag: Chy400_2953
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: Chy400_2952
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: Chy400_2951
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: Chy400_2950
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) |
||||
bfrR-bfrE-bfrF-bfrG-bfrA | -46 | 6.2 | GTCAATGAACGACCAATCTC | Chy400_2954 |