Orthologous regulated operons containing Cagg_1452 gene
| Regulog: | ModR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chloroflexus sp. Y-400-fl | ||||
|
Position: -166
Score: 6.87022 Sequence: AGTATTCACAATGTGAATACT
Locus tag: Chy400_2684
Name: null Funciton: oxidoreductase molybdopterin binding |
||||
| Chy400_2684 | -166 | 6.9 | AGTATTCACAATGTGAATACT | Chy400_2684 |