Orthologous regulated operons containing modB gene
Regulog: | ModR - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | PadR |
Regulation mode: | repressor |
Biological process: | Molybdenum homeostasis |
Effector: | Molybdate |
Phylum: | Chloroflexi |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Chloroflexus aggregans DSM 9485 | ||||
Position: -82
Score: 6.10895 Sequence: AGTACTCACATCGTGAATATA
Locus tag: Cagg_1371
Name: modR Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
Locus tag: Cagg_1370
Name: modA Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
Locus tag: Cagg_1369
Name: modB Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Cagg_1368
Name: modC Funciton: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
Locus tag: Cagg_1367
Name: Cagg_1367 Funciton: Metal-dependent hydrolase |
||||
modR-modA-modB-modC-Cagg_1367 | -82 | 6.1 | AGTACTCACATCGTGAATATA | Cagg_1371 |
Chloroflexus sp. Y-400-fl | ||||
Position: -102
Score: 6.87022 Sequence: AGTATTCACATTGTGAATACT
Locus tag: Chy400_2685
Name: modR Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
Locus tag: Chy400_2686
Name: modA Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
Locus tag: Chy400_2687
Name: modB Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Chy400_2688
Name: null Funciton: ABC transporter related
Locus tag: Chy400_2689
Name: Cagg_1367 Funciton: Metal-dependent hydrolase |
||||
modR-modA-modB-Chy400_2688-Cagg_1367 | -102 | 6.9 | AGTATTCACATTGTGAATACT | Chy400_2685 |