Orthologous regulated operons containing modR gene

Properties
Regulog:	ModR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Chloroflexi

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -82 Score: 6.10895 Sequence: AGTACTCACATCGTGAATATA Locus tag: Cagg_1371 Name: modR Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family Locus tag: Cagg_1370 Name: modA Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) Locus tag: Cagg_1369 Name: modB Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Cagg_1368 Name: modC Funciton: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1) Locus tag: Cagg_1367 Name: Cagg_1367 Funciton: Metal-dependent hydrolase
modR-modA-modB-modC-Cagg_1367	-82	6.1	AGTACTCACATCGTGAATATA	Cagg_1371
Chloroflexus sp. Y-400-fl
Position: -102 Score: 6.87022 Sequence: AGTATTCACATTGTGAATACT Locus tag: Chy400_2685 Name: modR Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family Locus tag: Chy400_2686 Name: modA Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) Locus tag: Chy400_2687 Name: modB Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Chy400_2688 Name: null Funciton: ABC transporter related Locus tag: Chy400_2689 Name: Cagg_1367 Funciton: Metal-dependent hydrolase
modR-modA-modB-Chy400_2688-Cagg_1367	-102	6.9	AGTATTCACATTGTGAATACT	Chy400_2685
Roseiflexus castenholzii DSM 13941
Position: -27 Score: 5.31354 Sequence: TATATTTATTTTTTGAATAGT Locus tag: Rcas_2179 Name: modR Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
modR	-27	5.3	TATATTTATTTTTTGAATAGT	Rcas_2179