Orthologous regulated operons containing msmE gene
| Regulog: | MsmR - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Arthrobacter aurescens TC1 | ||||
|
Position: -59
Score: 6.4015 Sequence: TCATCGATACGCATCGTCGA
Position: -46
Score: 6.54515 Sequence: TCGTCGATACGCATCGATAA
Locus tag: AAur_3251
Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein
Locus tag: AAur_3252
Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1
Locus tag: AAur_3253
Name: msmG Funciton: Multiple sugar ABC transporter, permease protein 2
Locus tag: AAur_3254
Name: thuA Funciton: Trehalose utilization protein
Locus tag: AAur_3255
Name: AAur_3255 Funciton: putative dehydrogenase |
||||
| msmE-msmF-msmG-thuA-AAur_3255 | -59 | 6.4 | TCATCGATACGCATCGTCGA | AAur_3251 |
| -46 | 6.5 | TCGTCGATACGCATCGATAA | ||
| Arthrobacter sp. FB24 | ||||
|
Position: -48
Score: 6.54515 Sequence: TTGTCGATACGCATCGATGA
Locus tag: Arth_3465
Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein
Locus tag: Arth_3466
Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1
Locus tag: Arth_3467
Name: msmG Funciton: Multiple sugar ABC transporter, permease protein 2
Locus tag: Arth_3468
Name: thuA Funciton: Trehalose utilization protein
Locus tag: Arth_3469
Name: AAur_3255 Funciton: putative dehydrogenase |
||||
| msmE-msmF-msmG-thuA-AAur_3255 | -48 | 6.5 | TTGTCGATACGCATCGATGA | Arth_3465 |