Orthologous regulated operons containing frcB gene
Regulog: | FruR - Micrococcineae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Fructose utilization |
Effector: | Fructose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||||
Position: -131
Score: 5.79954 Sequence: GGATGACAACGGTGTCACGA
Position: -52
Score: 6.30953 Sequence: ACCTGACAACGTTGTCGGGA
Locus tag: CMM_2842
Name: frcB Funciton: Fructose ABC transporter, substrate-binding component FrcB
Locus tag: CMM_2843
Name: frcC Funciton: Fructose ABC transporter, permease component FrcC
Locus tag: CMM_2844
Name: frcA Funciton: Fructose ABC transporter, ATP-binding component FrcA |
||||
frcB-frcC-frcA | -131 | 5.8 | GGATGACAACGGTGTCACGA | CMM_2842 |
-52 | 6.3 | ACCTGACAACGTTGTCGGGA | ||
Janibacter sp. HTCC2649 | ||||
Position: -122
Score: 6.38307 Sequence: TCCTGACAACGATGTCACGG
Position: -44
Score: 6.52128 Sequence: CCATGACAACGTTGTCATCG
Locus tag: JNB_11224
Name: frcB Funciton: Fructose ABC transporter, substrate-binding component FrcB
Locus tag: JNB_11219
Name: frcC Funciton: Fructose ABC transporter, permease component FrcC
Locus tag: JNB_11214
Name: frcA Funciton: Fructose ABC transporter, ATP-binding component FrcA |
||||
frcB-frcC-frcA | -122 | 6.4 | TCCTGACAACGATGTCACGG | JNB_11224 |
-44 | 6.5 | CCATGACAACGTTGTCATCG |