Orthologous regulated operons containing sacC gene
| Regulog: | FruR - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Janibacter sp. HTCC2649 | ||||
|
Position: -34
Score: 5.85655 Sequence: GCATGACAACGTTGTCAACG
Locus tag: JNB_11239
Name: sacC Funciton: Levanase (EC 3.2.1.65)
Locus tag: JNB_11234
Name: sacC Funciton: Levanase (EC 3.2.1.65) |
||||
| sacC-sacC | -34 | 5.9 | GCATGACAACGTTGTCAACG | JNB_11239 |