Orthologous regulated operons containing frcR gene
| Regulog: | FruR - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||||
|
Position: -81
Score: 6.30953 Sequence: TCCCGACAACGTTGTCAGGT
Position: -2
Score: 5.79954 Sequence: TCGTGACACCGTTGTCATCC
Locus tag: CMM_2841
Name: frcR Funciton: Probable fructose utilization transcriptional regulator, LacI-family
Locus tag: CMM_2840
Name: scrK Funciton: Fructokinase (EC 2.7.1.4) |
||||
| frcR-scrK | -81 | 6.3 | TCCCGACAACGTTGTCAGGT | CMM_2841 |
| -2 | 5.8 | TCGTGACACCGTTGTCATCC | ||
| Janibacter sp. HTCC2649 | ||||
|
Position: -120
Score: 6.52128 Sequence: CGATGACAACGTTGTCATGG
Position: -42
Score: 6.38307 Sequence: CCGTGACATCGTTGTCAGGA
Locus tag: JNB_11229
Name: frcR Funciton: Probable fructose utilization transcriptional regulator, LacI-family |
||||
| frcR | -120 | 6.5 | CGATGACAACGTTGTCATGG | JNB_11229 |
| -42 | 6.4 | CCGTGACATCGTTGTCAGGA | ||