Orthologous regulated operons containing rhaG gene
Regulog: | RhaR - Nocardiaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Rhamnose utilization |
Effector: | Rhamnose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Rhodococcus sp. RHA1 | ||||
Position: -218
Score: 5.77936 Sequence: CTCTTGAATCGCTTCAGTCC
Position: -30
Score: 6.05618 Sequence: GAAATGAACCGTTTCAATCG
Locus tag: RHA1_ro04085
Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: RHA1_ro04086
Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: RHA1_ro04087
Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: RHA1_ro04088
Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: RHA1_ro04089
Name: rhaM Funciton: L-rhamnose mutarotase
Locus tag: RHA1_ro04090
Name: rhaI Funciton: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14)
Locus tag: RHA1_ro04091
Name: null Funciton: putative L-arabinose isomerase
Locus tag: RHA1_ro04092
Name: rhaEW Funciton: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22)
Locus tag: RHA1_ro04093
Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5) |
||||
rhaG-rhaJ-rhaH-rhaF-rhaM-rhaI-RHA1_ro04091-rhaEW-rhaB | -218 | 5.8 | CTCTTGAATCGCTTCAGTCC | RHA1_ro04085 |
-30 | 6.1 | GAAATGAACCGTTTCAATCG |