Orthologous regulated operons containing ramA gene
| Regulog: | RhaR - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Brachybacterium faecium DSM 4810 | ||||
|
Position: -91
Score: 4.62958 Sequence: AGCTTGAGTCGTTTCACACC
Locus tag: Bfae_29670
Name: ramA Funciton: Alfa-L-rhamnosidase (EC 3.2.1.40) |
||||
| ramA | -91 | 4.6 | AGCTTGAGTCGTTTCACACC | Bfae_29670 |