Orthologous regulated operons containing rhaY gene
| Regulog: | RhaR - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Brachybacterium faecium DSM 4810 | ||||
|
Position: -136
Score: 5.47225 Sequence: GCTTTGAAACGAATCAATAT
Locus tag: Bfae_28350
Name: rhaY Funciton: Predicted L-rhamnose permease RhaY
Locus tag: Bfae_28340
Name: ramA2 Funciton: alpha-L-rhamnosidase |
||||
| rhaY-ramA2 | -136 | 5.5 | GCTTTGAAACGAATCAATAT | Bfae_28350 |