Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rhaY gene

Properties
Regulog: RhaR - Micrococcineae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Phylum: Actinobacteria
Built upon 29 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Brachybacterium faecium DSM 4810
Position: -136
Score: 5.47225
Sequence: GCTTTGAAACGAATCAATAT
Locus tag: Bfae_28350
Name: rhaY
Funciton: Predicted L-rhamnose permease RhaY
Locus tag: Bfae_28340
Name: ramA2
Funciton: alpha-L-rhamnosidase
rhaY-ramA2 -136 5.5 GCTTTGAAACGAATCAATAT Bfae_28350