Orthologous regulated operons containing Achl_3115 gene
Regulog: | RhaR - Micrococcineae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Rhamnose utilization |
Effector: | Rhamnose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Arthrobacter chlorophenolicus A6 | ||||
Position: -136
Score: 5.21158 Sequence: GCTGTGTAACGATTCAAAAA
Position: -68
Score: 4.77929 Sequence: GAAATGAAACGTATCAACCT
Locus tag: Achl_3116
Name: yteU Funciton: Putative membrane enzyme for rhamnogalaturonan degradation
Locus tag: Achl_3115
Name: null Funciton: hypothetical protein
Locus tag: Achl_3114
Name: ytcQ Funciton: Predicted unsaturated rhamnogalacturonyl ABC transporter, substrate-binding component
Locus tag: Achl_3113
Name: yteP Funciton: Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 1
Locus tag: Achl_3112
Name: ytcP Funciton: Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 2
Locus tag: Achl_3111
Name: yesT Funciton: Rhamnogalacturonan acetylesterase
Locus tag: Achl_3110
Name: yesU Funciton: hypothetical protein |
||||
yteU-Achl_3115-ytcQ-yteP-ytcP-yesT-yesU | -136 | 5.2 | GCTGTGTAACGATTCAAAAA | Achl_3116 |
-68 | 4.8 | GAAATGAAACGTATCAACCT |