Orthologous regulated operons containing AAur_3306 gene
| Regulog: | RhaR - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Arthrobacter aurescens TC1 | ||||
|
Position: -91
Score: 4.9468 Sequence: ATATTGTATCGATTCAGAAC
Locus tag: AAur_3309
Name: rhiN Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: AAur_3308
Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: AAur_3307
Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: AAur_3306
Name: AAur_3306 Funciton: hypothetical protein
Locus tag: AAur_3305
Name: AAur_3305 Funciton: putative transmembrane efflux protein (MFS) |
||||
| rhiN-rhiF-rhiG-AAur_3306-AAur_3305 | -91 | 4.9 | ATATTGTATCGATTCAGAAC | AAur_3309 |
| Arthrobacter chlorophenolicus A6 | ||||
|
Position: -92
Score: 4.91745 Sequence: ATATTGTATCGTTTCAGAAG
Locus tag: Achl_3124
Name: rhiN Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: Achl_3123
Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: Achl_3122
Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: Achl_3121
Name: AAur_3306 Funciton: hypothetical protein
Locus tag: Achl_3120
Name: AAur_3305 Funciton: putative transmembrane efflux protein (MFS) |
||||
| rhiN-rhiF-rhiG-AAur_3306-AAur_3305 | -92 | 4.9 | ATATTGTATCGTTTCAGAAG | Achl_3124 |
| Arthrobacter sp. FB24 | ||||
|
Position: -100
Score: 5.06509 Sequence: ATATTGTATCGTTTCAGAAA
Locus tag: Arth_3324
Name: rhiN Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: Arth_3323
Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: Arth_3322
Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: Arth_3321
Name: AAur_3306 Funciton: hypothetical protein
Locus tag: Arth_3320
Name: AAur_3305 Funciton: putative transmembrane efflux protein (MFS) |
||||
| rhiN-rhiF-rhiG-AAur_3306-AAur_3305 | -100 | 5.1 | ATATTGTATCGTTTCAGAAA | Arth_3324 |