Orthologous regulated operons containing rhiF gene

Properties
Regulog:	RhaR - Micrococcineae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Phylum:	Actinobacteria

Built upon 29 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -91 Score: 4.9468 Sequence: ATATTGTATCGATTCAGAAC Locus tag: AAur_3309 Name: rhiN Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: AAur_3308 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: AAur_3307 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: AAur_3306 Name: AAur_3306 Funciton: hypothetical protein Locus tag: AAur_3305 Name: AAur_3305 Funciton: putative transmembrane efflux protein (MFS)
rhiN-rhiF-rhiG-AAur_3306-AAur_3305	-91	4.9	ATATTGTATCGATTCAGAAC	AAur_3309
Arthrobacter chlorophenolicus A6
Position: -92 Score: 4.91745 Sequence: ATATTGTATCGTTTCAGAAG Locus tag: Achl_3124 Name: rhiN Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: Achl_3123 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: Achl_3122 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: Achl_3121 Name: AAur_3306 Funciton: hypothetical protein Locus tag: Achl_3120 Name: AAur_3305 Funciton: putative transmembrane efflux protein (MFS)
rhiN-rhiF-rhiG-AAur_3306-AAur_3305	-92	4.9	ATATTGTATCGTTTCAGAAG	Achl_3124
Arthrobacter sp. FB24
Position: -100 Score: 5.06509 Sequence: ATATTGTATCGTTTCAGAAA Locus tag: Arth_3324 Name: rhiN Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: Arth_3323 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: Arth_3322 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: Arth_3321 Name: AAur_3306 Funciton: hypothetical protein Locus tag: Arth_3320 Name: AAur_3305 Funciton: putative transmembrane efflux protein (MFS)
rhiN-rhiF-rhiG-AAur_3306-AAur_3305	-100	5.1	ATATTGTATCGTTTCAGAAA	Arth_3324