Orthologous regulated operons containing rhiF gene
Regulog: | RhaR - Frankineae/Propionibacterineae/Pseudonocardiaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Rhamnose utilization |
Effector: | Rhamnose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Actinosynnema mirum DSM 43827 | ||||
Position: -132
Score: 4.74619 Sequence: CCTGTGAACCGATTCAACGC
Position: -34
Score: 5.07539 Sequence: GGCTTGAACCGATTCAACCA
Locus tag: Amir_0970
Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: Amir_0971
Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: Amir_0972
Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: Amir_0973
Name: null Funciton: hypothetical protein
Locus tag: Amir_0974
Name: rhaM Funciton: L-rhamnose mutarotase
Locus tag: Amir_0975
Name: rhaR Funciton: Transcriptional regulator of rhamnose utilization, LacI family |
||||
rhiL-rhiF-rhiG-Amir_0973-rhaM-rhaR | -132 | 4.7 | CCTGTGAACCGATTCAACGC | Amir_0970 |
-34 | 5.1 | GGCTTGAACCGATTCAACCA |