Orthologous regulated operons containing rhaG gene

Properties
Regulog:	RhaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Phylum:	Actinobacteria

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Actinosynnema mirum DSM 43827
Position: -152 Score: 4.61003 Sequence: AGCTTGAAACGATTTAGCCG Position: -31 Score: 5.09587 Sequence: AGATTGAAACCTTTCATTCC Locus tag: Amir_3041 Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component Locus tag: Amir_3042 Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 2 Locus tag: Amir_3043 Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 1 Locus tag: Amir_3044 Name: rhaF Funciton: L-rhamnose ABC transporter, duplicated periplasmic rhamnose-binding protein Locus tag: Amir_3045 Name: rhaI Funciton: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) Locus tag: Amir_3046 Name: rhaEW Funciton: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) Locus tag: Amir_3047 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
rhaG-rhaH-rhaJ-rhaF-rhaI-rhaEW-rhaB	-152	4.6	AGCTTGAAACGATTTAGCCG	Amir_3041
	-31	5.1	AGATTGAAACCTTTCATTCC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --