Orthologous regulated operons containing rhaY gene
| Regulog: | RhaR - Frankineae/Propionibacterineae/Pseudonocardiaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Saccharopolyspora erythraea NRRL 2338 | ||||
|
Position: -116
Score: 4.66511 Sequence: GCTATAAATCGTTTCACAGG
Locus tag: SACE_4106
Name: rhaY Funciton: Predicted L-rhamnose permease RhaY |
||||
| rhaY | -116 | 4.7 | GCTATAAATCGTTTCACAGG | SACE_4106 |