Orthologous regulated operons containing SAV_1329 gene

Properties
Regulog:	AAur_4078 - Micrococcineae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:
Phylum:	Actinobacteria

Built upon 21 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -177 Score: 5.87147 Sequence: AACTGTGTGCGCTCCCAGTA Position: -90 Score: 5.9381 Sequence: AACTGGAACCGCTCACAGTC Locus tag: AAur_4081 Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: AAur_4080 Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1 Locus tag: AAur_4079 Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: AAur_4078 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
SAV_1326-SAV_1327-SAV_1328-SAV_1329	-177	5.9	AACTGTGTGCGCTCCCAGTA	AAur_4081
	-90	5.9	AACTGGAACCGCTCACAGTC
Beutenbergia cavernae DSM 12333
Position: -142 Score: 5.3892 Sequence: GGCTGGGACCGTGCACAGCA Position: -73 Score: 5.05964 Sequence: AACCGTGATCGTGCACAGGA Locus tag: Bcav_3075 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
SAV_1329	-142	5.4	GGCTGGGACCGTGCACAGCA	Bcav_3075
	-73	5.1	AACCGTGATCGTGCACAGGA
Brachybacterium faecium DSM 4810
Position: -179 Score: 4.90849 Sequence: AACTGGAATCGATCACGGGT Position: -79 Score: 5.86552 Sequence: GACTGTAAACGATCACAGTT Locus tag: Bfae_04000 Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: Bfae_04010 Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1 Locus tag: Bfae_04020 Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: Bfae_04030 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
SAV_1326-SAV_1327-SAV_1328-SAV_1329	-179	4.9	AACTGGAATCGATCACGGGT	Bfae_04000
	-79	5.9	GACTGTAAACGATCACAGTT
Jonesia denitrificans DSM 20603
Position: -178 Score: 5.549 Sequence: CGCTGTGCGCGGTCACAGCC Position: -89 Score: 5.52215 Sequence: TCCTGTGACCGGTCACAGCG Locus tag: Jden_0310 Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein Locus tag: Jden_0309 Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1 Locus tag: Jden_0308 Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2 Locus tag: Jden_0307 Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
SAV_1326-SAV_1327-SAV_1328-SAV_1329	-178	5.5	CGCTGTGCGCGGTCACAGCC	Jden_0310
	-89	5.5	TCCTGTGACCGGTCACAGCG