Orthologous regulated operons containing SAV_1326 gene
| Regulog: | AAur_4078 - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Arthrobacter aurescens TC1 | ||||
|
Position: -177
Score: 5.87147 Sequence: AACTGTGTGCGCTCCCAGTA
Position: -90
Score: 5.9381 Sequence: AACTGGAACCGCTCACAGTC
Locus tag: AAur_4081
Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: AAur_4080
Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1
Locus tag: AAur_4079
Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: AAur_4078
Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family |
||||
| SAV_1326-SAV_1327-SAV_1328-SAV_1329 | -177 | 5.9 | AACTGTGTGCGCTCCCAGTA | AAur_4081 |
| -90 | 5.9 | AACTGGAACCGCTCACAGTC | ||
| Brachybacterium faecium DSM 4810 | ||||
|
Position: -179
Score: 4.90849 Sequence: AACTGGAATCGATCACGGGT
Position: -79
Score: 5.86552 Sequence: GACTGTAAACGATCACAGTT
Locus tag: Bfae_04000
Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: Bfae_04010
Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1
Locus tag: Bfae_04020
Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: Bfae_04030
Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family |
||||
| SAV_1326-SAV_1327-SAV_1328-SAV_1329 | -179 | 4.9 | AACTGGAATCGATCACGGGT | Bfae_04000 |
| -79 | 5.9 | GACTGTAAACGATCACAGTT | ||
| Jonesia denitrificans DSM 20603 | ||||
|
Position: -178
Score: 5.549 Sequence: CGCTGTGCGCGGTCACAGCC
Position: -89
Score: 5.52215 Sequence: TCCTGTGACCGGTCACAGCG
Locus tag: Jden_0310
Name: SAV_1326 Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: Jden_0309
Name: SAV_1327 Funciton: Predicted galactosides ABC transporter, permease protein 1
Locus tag: Jden_0308
Name: SAV_1328 Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: Jden_0307
Name: SAV_1329 Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family |
||||
| SAV_1326-SAV_1327-SAV_1328-SAV_1329 | -178 | 5.5 | CGCTGTGCGCGGTCACAGCC | Jden_0310 |
| -89 | 5.5 | TCCTGTGACCGGTCACAGCG | ||