Orthologous regulated operons containing Bcav_3077 gene
| Regulog: | AAur_4078 - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Beutenbergia cavernae DSM 12333 | ||||
|
Position: -147
Score: 5.05964 Sequence: TCCTGTGCACGATCACGGTT
Position: -78
Score: 5.3892 Sequence: TGCTGTGCACGGTCCCAGCC
Locus tag: Bcav_3076
Name: lacA Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: Bcav_3077
Name: Bcav_3077 Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: Bcav_3078
Name: Bcav_3078 Funciton: Predicted galactosides ABC transporter, permease protein
Locus tag: Bcav_3079
Name: Bcav_3079 Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: Bcav_3080
Name: ganA Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
||||
| lacA-Bcav_3077-Bcav_3078-Bcav_3079-ganA | -147 | 5.1 | TCCTGTGCACGATCACGGTT | Bcav_3076 |
| -78 | 5.4 | TGCTGTGCACGGTCCCAGCC | ||